View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1107_low_69 (Length: 354)
Name: NF1107_low_69
Description: NF1107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1107_low_69 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 13 - 262
Target Start/End: Complemental strand, 3678769 - 3678520
Alignment:
| Q |
13 |
aatatcaccaatttcatgtatagaaatcgcagcctctccataccctatggcctataccagcaaccaacatttaattctgtcattattggttcaccttaaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3678769 |
aatatcaccaatttcatgtatagaaatcgcagcctctccataccctatggcctataccagcaaccaacatttaattctgtcattattggttcaccttaaa |
3678670 |
T |
 |
| Q |
113 |
agtcttcttgttaagtgctagctgctatgatggagcattctgcagttggttgctccagtgcttaatgaacaaggactgatctaatctaagcgtaacatat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3678669 |
agtcttcttgttaagtgctagctgctatgatggagcattctgcagttggttgctccagtgcttaatgaacaaggactgatctaatctaagcgtaacatat |
3678570 |
T |
 |
| Q |
213 |
tcaagcagttgccccaacaagcttaaattatttctttagtgggttaatga |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3678569 |
tcaagcagttgccccaacaagcttaaattatttctttagtgggttaatga |
3678520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University