View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1107_low_71 (Length: 349)

Name: NF1107_low_71
Description: NF1107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1107_low_71
NF1107_low_71
[»] chr4 (1 HSPs)
chr4 (139-349)||(24909451-24909657)


Alignment Details
Target: chr4 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 139 - 349
Target Start/End: Complemental strand, 24909657 - 24909451
Alignment:
139 ggtcatttacatcgggttgaatttgtcttcgagtaatacaaggtcatagaatatataggatcatttactctctaataaaggatattacaatttgaatcca 238  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    |||||||||||||||||||||||||||||||||||||||||||    
24909657 ggtcatttacatcgggttgaatttgtcttcgagtaatacaaggtcatagaata----ggatcatttactctctaataaaggatattacaatttgaatcca 24909562  T
239 aggtcaattcaagtgtacttagactacactattgatttacaacatgatctaatgactctcttttgaaaggatattacaatgaatttatacatcatgttct 338  Q
    || ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||    
24909561 agatcaattcaagtgtacttagactacactattgatttgcaacatgatctaatcactctcttttgagaggatattacaatgaatttatacatcatgttct 24909462  T
339 tggtatttctt 349  Q
    |||| ||||||    
24909461 tggtttttctt 24909451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University