View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1107_low_81 (Length: 327)
Name: NF1107_low_81
Description: NF1107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1107_low_81 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 121; Significance: 6e-62; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 121; E-Value: 6e-62
Query Start/End: Original strand, 101 - 250
Target Start/End: Complemental strand, 3874157 - 3874008
Alignment:
| Q |
101 |
actttatggttaccaatgttgctttttgtattggttttagtcatatctttatcagnnnnnnnggataagagcttcacaaggtttgatcgtaattggattc |
200 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3874157 |
actttatggttaccaatgttactttttgtattggttttagtcatatctttatcagcttttttggataagagcttcacaaggtttgatcgtaattggattc |
3874058 |
T |
|
| Q |
201 |
atagagttggtggttcttctggtggtattgttttcattcttattcatctc |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3874057 |
atagagttggtggttcttctggtggtattgttttcattcttattcttctc |
3874008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 101 - 250
Target Start/End: Complemental strand, 3884685 - 3884537
Alignment:
| Q |
101 |
actttatggttaccaatgttgctttttgtattggttttagtcatatctttatcagnnnnnnnggataagagcttcacaaggtttgatcgtaattggattc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3884685 |
actttatggttaccaatgttgctttttgtattggttttagtcatatctttatcagcttttttagataagagcttcacaaggtttgatcgtaattggattc |
3884586 |
T |
|
| Q |
201 |
atagagttggtggttcttctggtggtattgttttcattcttattcatctc |
250 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3884585 |
atagagttggt-gttcttctggtggtattgttttcattcttattcttctc |
3884537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University