View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1107_low_85 (Length: 318)
Name: NF1107_low_85
Description: NF1107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1107_low_85 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 96 - 306
Target Start/End: Complemental strand, 45712915 - 45712705
Alignment:
| Q |
96 |
ccaaatgaggcactacctagaatttcagcagacgcctttagcaaatcctgtaaatcaaacgttattccatcctgcctaaggaatataagcttgccttgtt |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45712915 |
ccaaatgaggcactacctagaatttcagcagacgcctttagcaaatcctgtaaatcaaacgttattccatcctgcctaaggaatataagcttgccttgtt |
45712816 |
T |
 |
| Q |
196 |
ccccctttttggaatgtccatgactgtggcgatcatgcttaggactttcgggatcataatgttcggccaagcttttggttttcacataaactacaggagg |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45712815 |
ccccctttttggaatgtccatgactgtggcgatcatgcttaggactttcgggatcataatgttcggccaagcttttggttttcacataaactacaggagg |
45712716 |
T |
 |
| Q |
296 |
cttaacatatt |
306 |
Q |
| |
|
||||||||||| |
|
|
| T |
45712715 |
cttaacatatt |
45712705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University