View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1107_low_86 (Length: 317)
Name: NF1107_low_86
Description: NF1107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1107_low_86 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 17 - 198
Target Start/End: Complemental strand, 27302807 - 27302626
Alignment:
| Q |
17 |
taatagtgatgaaatatttgtaattgatcaacattagaaatgacacataacagtgtagcaatacatgtctagaagctgtattttatatagggaaaaatgc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
27302807 |
taatagtgatgaaatatttgtaattgatcaacattagaaatgacacataacagtgtagcaatacatgtttagaagctgtattttatatagggaaaaatgc |
27302708 |
T |
 |
| Q |
117 |
cacacccatgttgagcacaacatcatctacgaataaatgtgaatttctccgaccataacactattgactataccaatcaatt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27302707 |
cacacccatgttgagcacaacatcatctacgaataaatgtgaatgtctccgaccataacactattgactataccaatcaatt |
27302626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 257 - 288
Target Start/End: Complemental strand, 27302335 - 27302304
Alignment:
| Q |
257 |
cggtcaccatccccatgaccatgtcagcagag |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
27302335 |
cggtcaccatccccatgaccatgtcagcagag |
27302304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University