View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1107_low_89 (Length: 310)
Name: NF1107_low_89
Description: NF1107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1107_low_89 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 1 - 275
Target Start/End: Complemental strand, 26795350 - 26795076
Alignment:
| Q |
1 |
tcctaatatgtctaatatttcaggttctgatgagttcaaatttccggctgttgcgagttccatgaccacattgacatgtgttcaggtgcactctatggac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
26795350 |
tcctaatatgtctaatatttcaggttctgatgagttcaaatttccggctgttacgagttccatgaccacattgacatgtgttcaggtgcgctctatggac |
26795251 |
T |
|
| Q |
101 |
gaaacggtcaatgaaacagcctatcaaacaagtgtagaaattggaggacatgtatttagtggtattctttatgatcaaggccctgatgaacaaagcttca |
200 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26795250 |
gaaacggtcaatgaaacggcctatcaaacaagtgtagaaattggaggacatgtatttagtggcattctttatgatcaaggccctgatgaacaaagcttca |
26795151 |
T |
|
| Q |
201 |
ataatatacacccccttgatcagcaacaaaatctcaatctttttagtagtaatgcaatccacaccggtgatgatg |
275 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
26795150 |
ataatatacaccctcttgatcagcaacaaaatctcaatctttttagtagtaatgtaatccacaccggtgatgatg |
26795076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University