View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1107_low_90 (Length: 308)
Name: NF1107_low_90
Description: NF1107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1107_low_90 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 4e-81; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 87 - 239
Target Start/End: Original strand, 22984500 - 22984652
Alignment:
| Q |
87 |
cttcaaagtggatgatggaaaatggtgacattcctcatgttcttgctgttgacgacaatatcattgatcgcacacttgttgagaaacaccttaagaattc |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22984500 |
cttcaaagtggatgatggaaaatggtgacattcctcatgttcttgctgttgacgacaatatcattgatcgcacacttgttgagaaacaccttaagaattc |
22984599 |
T |
|
| Q |
187 |
ctcttgcaaaggtacgtacacctacctctcactcaaccattttatgttatatt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22984600 |
ctcttgcaaaggtacgtacacctacctctcactcaaccattttatgttatatt |
22984652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 87 - 236
Target Start/End: Complemental strand, 42884136 - 42883987
Alignment:
| Q |
87 |
cttcaaagtggatgatggaaaatggtgacattcctcatgttcttgctgttgacgacaatatcattgatcgcacacttgttgagaaacaccttaagaattc |
186 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
42884136 |
cttcaaagtgggtgatggaaaatggtgacattcctcatgttctggctgttgatgacaatatcattgatcgcacacttgttgagaaacttctgaagaattc |
42884037 |
T |
|
| Q |
187 |
ctcttgcaaaggtacgtacacctacctctcactcaaccattttatgttat |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42884036 |
ctcttgcaaaggtacgtacacctacctctcactcaaccattttctgttat |
42883987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University