View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1107_low_93 (Length: 300)
Name: NF1107_low_93
Description: NF1107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1107_low_93 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 156; Significance: 7e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 85 - 251
Target Start/End: Original strand, 30135963 - 30136132
Alignment:
| Q |
85 |
caatcccattaaccttgcaactacaccagaa---gaagaagaagaaattatagttcttgtagtagtaggagtgttagtcttaaatttttgaactttttca |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30135963 |
caatcccattaaccttgcaactacaccagaagaagaagaagaagaaattatagttcttgtagtagtaggagtgttagtcttaaatttttgaactttttca |
30136062 |
T |
 |
| Q |
182 |
cttacaatgaactttgaatgaaactctctaatcctatgaaaaatggttgtgaaacaccctgcagcaacag |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30136063 |
cttacaatgaactttgaatgaaactctctaatcctatgaaaaatggttgtgaaacaccctgcagcaacag |
30136132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University