View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1107_low_99 (Length: 286)
Name: NF1107_low_99
Description: NF1107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1107_low_99 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 49 - 240
Target Start/End: Complemental strand, 37296870 - 37296679
Alignment:
| Q |
49 |
gagaggtcatcggtcatcctgaggaaactataccggcttagacttattatgatgtaactagtagtaaagatcatgtgcaagagtatggaatcatggggaa |
148 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
37296870 |
gagaggtcatcgctcatcctggggaaactataccggcttagacttattatgatgtaactagtagtaatgatcatgtgcaagagtatggaatcgtggggaa |
37296771 |
T |
 |
| Q |
149 |
caaaggcgtgaaatttcttcatatgtcatgtcattagcgaaagacttttcttaaaatagatagattggttacatggtttgaggtctgtgctc |
240 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37296770 |
caaaggcgtaaaatttcttcatatgtcatgtcattagcgaaagacttttcttaaaatagatagattggttgcatggtttgaggtctgtgctc |
37296679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University