View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1107_low_99 (Length: 286)

Name: NF1107_low_99
Description: NF1107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1107_low_99
NF1107_low_99
[»] chr2 (1 HSPs)
chr2 (49-240)||(37296679-37296870)


Alignment Details
Target: chr2 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 49 - 240
Target Start/End: Complemental strand, 37296870 - 37296679
Alignment:
49 gagaggtcatcggtcatcctgaggaaactataccggcttagacttattatgatgtaactagtagtaaagatcatgtgcaagagtatggaatcatggggaa 148  Q
    |||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||    
37296870 gagaggtcatcgctcatcctggggaaactataccggcttagacttattatgatgtaactagtagtaatgatcatgtgcaagagtatggaatcgtggggaa 37296771  T
149 caaaggcgtgaaatttcttcatatgtcatgtcattagcgaaagacttttcttaaaatagatagattggttacatggtttgaggtctgtgctc 240  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
37296770 caaaggcgtaaaatttcttcatatgtcatgtcattagcgaaagacttttcttaaaatagatagattggttgcatggtttgaggtctgtgctc 37296679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University