View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11080_low_14 (Length: 269)
Name: NF11080_low_14
Description: NF11080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11080_low_14 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 269
Target Start/End: Complemental strand, 7361796 - 7361519
Alignment:
| Q |
1 |
ctatgtcttcctaaacatgtatggtacttttcctctctttctccccaagacattgatgttccatatcaacatcttcttgtcaccactttcttaaccattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7361796 |
ctatgtcttcctaaacatgtatggtacttttcctctctttctccccaagacattgatgttccatatcaacatcttcttgtcaccactttcttaaccattc |
7361697 |
T |
|
| Q |
101 |
aattttcgttctttaataattctaggctg---------acctcgatgaactatctgacaatgaggctgaagttcctgtcaatatacttttctttactatt |
191 |
Q |
| |
|
|||||||||| || ||||||||||||| ||||||| |||| |||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7361696 |
cattttcgttcatttataattctaggctactcttgctaacctcgactaactctctgacaacgaggctgaagttcctgtcaatatacttttctttactatt |
7361597 |
T |
|
| Q |
192 |
ttcattcattttatattttagtgtgtgtgattaaattgatgagtagtctggtttgtttttatcttcggcggataatga |
269 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
7361596 |
ttcattcattttatattttagtttgtgtgattaaattgatgagtagtgtggtttgtttttatcttcggcggataatga |
7361519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University