View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11083_low_2 (Length: 414)
Name: NF11083_low_2
Description: NF11083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11083_low_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 4e-82; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 4e-82
Query Start/End: Original strand, 223 - 396
Target Start/End: Complemental strand, 30472172 - 30471998
Alignment:
| Q |
223 |
tgtgagccaaatcttcaaccaccattgcaaatctccaaacgagatccaaacacttatcttctgctactcgaacgaaa-cccgtccacaaaaaccacaaat |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30472172 |
tgtgagccaaatcttcaaccaccattgcaaatctccaaacgagatccaaacacttatcttccactactcgaacgaaaacccgtccacaaaaaccacaaat |
30472073 |
T |
 |
| Q |
322 |
cgatggatggaggttttatatttaaggatggatgaaggtaattaaattggacatattaggatcaattgagtgatg |
396 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30472072 |
cgatggatggtggttttatatttaaggatggatgaaggtaattaaattggacatattaggatcaattgagtgatg |
30471998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 13 - 125
Target Start/End: Complemental strand, 30472382 - 30472270
Alignment:
| Q |
13 |
agcagagatcaacaacacaaaaacaagtaaaaggtgacgtagataggcggaacatccaacagaaaatccatacacttcggacatcaaatcactgacaaaa |
112 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
30472382 |
agcagagaccaacaacacaaaaacaagtaaaaggtgacgtagataggcggaacacccaacagaaaatccatacacttcggacatcaaatcaccgacaaaa |
30472283 |
T |
 |
| Q |
113 |
atatcactcaact |
125 |
Q |
| |
|
||||||||||||| |
|
|
| T |
30472282 |
atatcactcaact |
30472270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University