View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11084_high_2 (Length: 444)
Name: NF11084_high_2
Description: NF11084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11084_high_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 9 - 326
Target Start/End: Original strand, 40678953 - 40679268
Alignment:
| Q |
9 |
gattatactaaacagaagaacgtttatgtctctggtgagacaaaacaggacgcttagtcttagtgggattgacccatgtgggtcgtgggta-gataatac |
107 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| | || || || |
|
|
| T |
40678953 |
gattatacgaaacagaagaacgtttatgtctctggtgagacaaaacaggacgcttagtcttagtgggattgacccatgtgggttttggctttgacaaaac |
40679052 |
T |
|
| Q |
108 |
ttttggttggttttctgggacagtggataacgttgtatttgcaagagaagcaagttggtcggataaagatgagnnnnnnnngtcgttgttgttgtttggt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
40679053 |
ttttggttggttttctgggacagtggataacgttgtatttgcaagagaagcaagttggtcggataaagatgagttttttttgttgttgttgttgtttggt |
40679152 |
T |
|
| Q |
208 |
ggggtggtttcagaatctggaatggatttggaagaagagatgagaaaccttctgtgagattttagggtagtagtagtagtaggagggaatttgaaccctg |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| || |
|
|
| T |
40679153 |
ggggtggtttcagaatctggaatggatttggaagaagagatgagaaaccttctgtgagattttagg---gtagtagtagtaggagggaatttgaaccttg |
40679249 |
T |
|
| Q |
308 |
ttcgtgttgttttggtgtc |
326 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
40679250 |
ttcgtgttgttttggtgtc |
40679268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University