View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11084_high_6 (Length: 320)
Name: NF11084_high_6
Description: NF11084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11084_high_6 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 299; Significance: 1e-168; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 10 - 320
Target Start/End: Original strand, 44995530 - 44995840
Alignment:
| Q |
10 |
gcaaataggattctgaaagatgcggttttcaagggttttaaaccagacgagtttacctattgttccttagttaatggtttttgccaggatggtgaccctg |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44995530 |
gcaaataggattctgaaagatgcggttttcaagggttttaagccagacgagtttacctattgttccttagttaatggtttttgccaggatggtgaccctg |
44995629 |
T |
|
| Q |
110 |
atcaggctatggctgtctttaaggatgggctaggaaaaggtttaaggccgagcattattgtttacaataccttgattaaagggttatgtcagcaaggtct |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44995630 |
atcaggctatggctgtctttaaggatgggctaggaaaaggtttaaggccgagcattattgtttacaataccttgattaaagggttatgtcagcaaggtct |
44995729 |
T |
|
| Q |
210 |
gattttgccggctttgcaattgatgaatgagatgacagaaaagggttgtaaacctgatatatggacttataatttaattataaatggcttgtgcaagatg |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
44995730 |
gattttgccggctttgcaattgatgaatgagatggcagaaaagggttgtaaacctgatatatggacttataatttaattataaatggcctgtgcaagatg |
44995829 |
T |
|
| Q |
310 |
ggttgtttatc |
320 |
Q |
| |
|
||||||||||| |
|
|
| T |
44995830 |
ggttgtttatc |
44995840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University