View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11085_high_23 (Length: 241)
Name: NF11085_high_23
Description: NF11085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11085_high_23 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 17 - 241
Target Start/End: Original strand, 35637591 - 35637815
Alignment:
| Q |
17 |
attctgcccataatgtatgctgcaagtgcatgatgaacaaaataatgaaaatgaaaatatgaaacaaagggaattctaacttctaaggtctcaattttaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
35637591 |
attctgcccataatgtatgctgcaagtgcatgatgaactaaataatgaaaatgaaaatatgaaacaaagggaattctaacttataaggtctcaattttaa |
35637690 |
T |
 |
| Q |
117 |
tcaaattaagcctgaggttttatgaatgtccagcttattaatagttaatgagattgaatatattaactttttagtttattggatatcaaccaaaatttgt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| | |
|
|
| T |
35637691 |
tcaaattaagcctgaggttttatgaatgtccagcttattaatagttaatgagattgaatatattaactttttagtttattgtatatcaaccaaaatttat |
35637790 |
T |
 |
| Q |
217 |
gcaaaataattcatttattacaaat |
241 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
35637791 |
gcaaaataattcatttattacaaat |
35637815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University