View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11085_high_32 (Length: 212)
Name: NF11085_high_32
Description: NF11085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11085_high_32 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 12 - 196
Target Start/End: Complemental strand, 2518041 - 2517857
Alignment:
| Q |
12 |
gagaagaacatacattgtagtgatagaagtagccgtcattcttgctcaggccaactcgaaaatggttcgctaagagttgtatcttggctccctcggatcc |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2518041 |
gagaagaacatacattgtagtgatagaagtagccgtcattcttgctcaggccaactcgaaaatggttcgctaagagttgtatcttggctcccttggatcc |
2517942 |
T |
 |
| Q |
112 |
aagacctctcctggccatgggcacatggtttgaattcaatgtctttctcatttcctcattgttcaatgagtattccatttcttag |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2517941 |
aagacctctcctggccatgggcacatggtttgaattcaatgtctttctcatttcctcattgttcaatgagtattccatttcttag |
2517857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University