View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11085_low_12 (Length: 397)
Name: NF11085_low_12
Description: NF11085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11085_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 14 - 239
Target Start/End: Complemental strand, 39928752 - 39928527
Alignment:
| Q |
14 |
gcttcaagtcacgtcacgccactctcagcaacatatacatacttttattttaatctttccattttatattatcaagaatcattccaagcgaaagtttttc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
39928752 |
gcttcaagtcacgtcacgccactctcagcaacatatacatacttttatttaaatctttccattttatattctcaagaatcattccaagcgaaagtttttc |
39928653 |
T |
|
| Q |
114 |
ttggtggatgaacatatgggtcattggtttcccatatgaagaggtacttattttatgattcgaatcttagtttcattcaaactgtccgtgaataataatg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39928652 |
ttggtggatgaacatatgggtcattggtttcccatatgaagaggtacttattttatgatttgaatcttagtttcattcaaactgtccgtgaataataatg |
39928553 |
T |
|
| Q |
214 |
cttcttctatggaaggttgttgtcat |
239 |
Q |
| |
|
||||||||||| |||||||||||||| |
|
|
| T |
39928552 |
cttcttctatgcaaggttgttgtcat |
39928527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 336 - 381
Target Start/End: Complemental strand, 39928411 - 39928366
Alignment:
| Q |
336 |
tagaagagaataggcacgtgtttaatccatttcaaaaacatattta |
381 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39928411 |
tagaagagaataggcacgtgtttaatccatttcaaaaacatattta |
39928366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 242 - 272
Target Start/End: Complemental strand, 39928508 - 39928478
Alignment:
| Q |
242 |
tactactcacacctttcttcaactcttcttg |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
39928508 |
tactactcacacctttcttcaactcttcttg |
39928478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 254 - 306
Target Start/End: Complemental strand, 34074626 - 34074573
Alignment:
| Q |
254 |
ctttcttcaactcttcttgcagatgcaatg-aagttagtttattgagagattag |
306 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||| ||||||| |||| |
|
|
| T |
34074626 |
ctttcttcaactcttcttgctgatgcaatgtgagttagtttcttgagagcttag |
34074573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University