View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11085_low_23 (Length: 245)
Name: NF11085_low_23
Description: NF11085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11085_low_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 27 - 230
Target Start/End: Complemental strand, 33652002 - 33651798
Alignment:
| Q |
27 |
agttcattctatagcatgtcctacatatatcagaaaaccatgtgagaagacacttgcattacattacatatttttatttttnnnnnnnn-cattattatc |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
33652002 |
agttcattctatagcatgtcctacatatatcagaaaaccatgtgagaagacacttgcattacattacatatttttatttttaaaaaaaaacattattatc |
33651903 |
T |
 |
| Q |
126 |
aaattaaattttaatagttctcacaaacttgcattggcagaatgagttttgcatgatcatccactatagttaagaaataatttggtaaatatgaatgtct |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33651902 |
aaattaaattttaatagttctcacaaacttgcattggcagaatgagttttgcataatcatccactatagttaagaaataatttggtaaatatgaatgtct |
33651803 |
T |
 |
| Q |
226 |
ctgct |
230 |
Q |
| |
|
||||| |
|
|
| T |
33651802 |
ctgct |
33651798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University