View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11086_low_13 (Length: 208)
Name: NF11086_low_13
Description: NF11086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11086_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 174; Significance: 8e-94; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 14 - 191
Target Start/End: Original strand, 4065094 - 4065271
Alignment:
| Q |
14 |
cagagattcaaataacctggaatttagacagcattggcgacttggttatagagtcatcagaaaattgcaaaccagcatggaagtcaggaaagcttattat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4065094 |
cagagattcaaataacctggaatttagacagcattggcgacttggttatagagtcatcagaaaattgcaaaccagcatggaagtcaggaaagcttattat |
4065193 |
T |
 |
| Q |
114 |
tgctgatgggatatcaagtccttgattagcatctggagggtattcatcaatgtgcaagaagccctatgcagaccaaca |
191 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4065194 |
tgctgatgggatatcaagtccttgagtagcatctggagggtattcatcaatgtgcaagaagccctatgcagaccaaca |
4065271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 21 - 191
Target Start/End: Original strand, 4058755 - 4058927
Alignment:
| Q |
21 |
tcaaataacctggaatttagacagcattggcgacttggttatagagtcatcagaaaattgcaaaccagcatggaagtcaggaaagcttattattgctgat |
120 |
Q |
| |
|
|||||||||||| |||||||| | ||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4058755 |
tcaaataacctgtaatttagataacattggcgacttgcttatagagtcattagaaaattgcaaaccagcatggaagtcaggaaagcttattattgctgat |
4058854 |
T |
 |
| Q |
121 |
gggatatcaagtccttgattagcatctggagggtattcatcaatgtgcaagaagcccta--tgcagaccaaca |
191 |
Q |
| |
|
||||| |||| ||| || || ||||||||||| |||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
4058855 |
gggatgtcaaatccctggttggcatctggaggatattcatcaatgtgcaagaagccctatgtgcagaccaaca |
4058927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University