View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11087_high_5 (Length: 257)
Name: NF11087_high_5
Description: NF11087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11087_high_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 12 - 240
Target Start/End: Complemental strand, 9214040 - 9213815
Alignment:
| Q |
12 |
gaagatgaagttattgttgtaagtgcatgagattatgcatgttattttcaagtactccaacttaattcatctgccaatgtaaattaatgttgttgttttt |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
9214040 |
gaagatgaagttattgttgtaagtgcatgagattatgtatgttattttcaagtactccaacttaattcatctgctaatgtaaattaatgttattgttttt |
9213941 |
T |
|
| Q |
112 |
gcagggttgtcagcttgggaaaaggtctatgatggctgctactgacttgttagctgctgtaagcatttcttctttcaattgctaatatttacagtgcaat |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| | |
|
|
| T |
9213940 |
gcagggttgtcagcttgggaaaaggtctatgatggctgctactgacttgttagctgctgtaagcatttcttctttcaattgctaatatttacattgcagt |
9213841 |
T |
|
| Q |
212 |
agttgattgctgcagttgaaaaaagtttc |
240 |
Q |
| |
|
||||||| ||||||||||||||||||| |
|
|
| T |
9213840 |
agttgat---tgcagttgaaaaaagtttc |
9213815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University