View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11087_low_10 (Length: 239)
Name: NF11087_low_10
Description: NF11087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11087_low_10 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 15 - 213
Target Start/End: Original strand, 28539958 - 28540156
Alignment:
| Q |
15 |
gataccgattgaatcaacatcaacagagccaacaacagcttccatgaacgcagcagcaatatggaaaacaccagcaacgaatctacgttgtcaagtaact |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28539958 |
gataccgattgaatcaacatcaacagagccaacaacagcttccatgaacgcagcagcagtatggaaaacaccagcaacgaatctacgttgtcaagtaact |
28540057 |
T |
|
| Q |
115 |
cgatcagaagttatagaaaacggattatcaccgcctctgagtccatgtagatcaccggtactaggcggtaccggaatcagaccagatctgacatcggct |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
28540058 |
cgatcagaagttatagaaaacggattatcaccacctatgagtccatgtagatcaccggtactaagcggtaccggaatcagaccagatctgacatcggct |
28540156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University