View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11089_high_35 (Length: 324)
Name: NF11089_high_35
Description: NF11089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11089_high_35 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 1 - 315
Target Start/End: Complemental strand, 6060750 - 6060436
Alignment:
| Q |
1 |
tgatgtcaacaattggctcaatgatctcaaagatgctgtatatgtagctgttgacttattggatgaagtttcgacaaaaactgtgattcaaaaagaggta |
100 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6060750 |
tgatgtcaacaactggctcaatgatctcaaagatgctgtctatgtagctgatgacttattggatgaagtttcgacaaaaactgtgattcaaaaagaggta |
6060651 |
T |
 |
| Q |
101 |
actaatctcttttcgcgctttttcaatgtgcaagatagggttatggttagtatgtttgaagatatagttgagagactagaatatatcttgaaactcaaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
6060650 |
actaatctcttttcgcgctttttcaatgtgcaagataggggtatggttagtaagtttgaagatatagttgagagactagaatatattttgaaactcaaag |
6060551 |
T |
 |
| Q |
201 |
acagtcttgaactcaaagagattgtagtggagaatttgtcatataaaactccatcaacatctctccaagacggatcacgtgtgtatggcagggacaaaga |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
6060550 |
acagtcttgaactcaaagagattgtagtggagaatttgtcatataaaactccatcaacatctctccaagacgaatctcgtgtgtatggcagggacaaaga |
6060451 |
T |
 |
| Q |
301 |
caaggagggcatcat |
315 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
6060450 |
caaggagggcatcat |
6060436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 8 - 64
Target Start/End: Original strand, 41932585 - 41932641
Alignment:
| Q |
8 |
aacaattggctcaatgatctcaaagatgctgtatatgtagctgttgacttattggat |
64 |
Q |
| |
|
||||| |||||| ||||||||||||||||||| ||||| |||| |||| | |||||| |
|
|
| T |
41932585 |
aacaaatggctcgatgatctcaaagatgctgtctatgttgctgatgacattttggat |
41932641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University