View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11089_high_48 (Length: 253)
Name: NF11089_high_48
Description: NF11089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11089_high_48 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 149 - 243
Target Start/End: Original strand, 6071722 - 6071815
Alignment:
| Q |
149 |
atatctaaaatgttattcattcatgtgagctggtaaagataggaacagaaatcaagcctagttgtgtttgtgcctccctctcctccgtgtctgtg |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6071722 |
atatctaaaatgttattcattcatgtgagccggtaaaaataggaacagaaatcaagcctagttgtgtttgtg-ctccctctcctccgtgtctgtg |
6071815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University