View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11089_high_50 (Length: 246)
Name: NF11089_high_50
Description: NF11089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11089_high_50 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 117; Significance: 1e-59; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 1 - 125
Target Start/End: Complemental strand, 13809898 - 13809774
Alignment:
| Q |
1 |
aaaaatggcctgaatcattgcttgttaatccctgtatgataagcatatgttaattatgtaattatgctactcaaactaggaagctagtccaaacaaaaca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13809898 |
aaaaatggcctgaatcattgcttgttaatccctgtatgataagtatatgttaattatgtaattatgctactcaaactaggaagctagtccaaacaaaaca |
13809799 |
T |
|
| Q |
101 |
gcccatacatctgtaatgcatctat |
125 |
Q |
| |
|
|||||||||||||||||| |||||| |
|
|
| T |
13809798 |
gcccatacatctgtaatgtatctat |
13809774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 150 - 240
Target Start/End: Complemental strand, 13809713 - 13809623
Alignment:
| Q |
150 |
ttttgagctattgttttctcgtaagcctgcatattctattctattaaacctcaatatacttagatttctcatatacttcatgacttctgtg |
240 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
13809713 |
ttttgagctattgttttctcgtaagcttgcatattctattctattaaacctcaatatacttagatttctcctatacttcatgacttctgtg |
13809623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 11 - 49
Target Start/End: Original strand, 3326902 - 3326940
Alignment:
| Q |
11 |
tgaatcattgcttgttaatccctgtatgataagcatatg |
49 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
3326902 |
tgaatcattggttgttaatccctgtatcataagcatatg |
3326940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University