View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11089_high_59 (Length: 209)
Name: NF11089_high_59
Description: NF11089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11089_high_59 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 20 - 190
Target Start/End: Complemental strand, 15851322 - 15851152
Alignment:
| Q |
20 |
aaatgggtctgaggttttctactcctaatgtctatatttttcttcgagtgttgctgatttcgttttctgctagcgttacttgtctatattgctgctttgt |
119 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
15851322 |
aaatgggtcctaggttttctactcctaatgtctatatttttcttcgagtgttgctgattttgttttctgctagcgttgcttgtctatattgctgctttgt |
15851223 |
T |
 |
| Q |
120 |
tcaaaacttgtctatatttactgctggttatcatgtgcaatattgcactggtgttattgatgtgactgcat |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15851222 |
tcaaaacttgtctatatttactgctggttatcatgtgcaatattgcactggtgttattgatgtgactgcat |
15851152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University