View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11089_low_33 (Length: 336)
Name: NF11089_low_33
Description: NF11089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11089_low_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 14 - 328
Target Start/End: Complemental strand, 12049527 - 12049210
Alignment:
| Q |
14 |
cattacccacaaagatacagcataaatcaattgtaaaaataataatttgtttttatatcaaaatgtta---tataaatagtattattgttgtagaaattc |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
12049527 |
cattacccacaaagatacagcataaatcaattgtaaaaataat---ttgtttttatatcaaaatgttaaaatataaatagtattattgttgtagaaattc |
12049431 |
T |
 |
| Q |
111 |
aatctccaacaataatactcattttagacgttagtttttaaattaattttaatccaattgtgttgcgagaaatttgtgatacaatcacagaaaatttggt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||| ||| |||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
12049430 |
aatctccaacaataatactcattttagacgttcgtttttaaattaattttgatcgaattgtgttgcgagaaatttgtgatacaatcacaaaaaatttggt |
12049331 |
T |
 |
| Q |
211 |
ataatcttataatt---ttattgtttcagtatgttatcatgttccttgccgtgattcgagtccgagccacggcagcaccattaaacgcagcatacacatc |
307 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12049330 |
ataatcttataattttgttgttgtttcagtatgttatcatgttccttgccgtgattcgagttcgagccacggcagcaccattaaacgcagcatacacatc |
12049231 |
T |
 |
| Q |
308 |
agaagaattcgagtttcatct |
328 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
12049230 |
agaagaattcgagttttatct |
12049210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University