View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11089_low_39 (Length: 319)
Name: NF11089_low_39
Description: NF11089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11089_low_39 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 17 - 305
Target Start/End: Original strand, 4365637 - 4365925
Alignment:
| Q |
17 |
aatatagttttaatccagagttgcaatcgataaaaactataaacggatagtcatacgatgtctgaaaattttctagattttattgaaggtattcagctaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4365637 |
aatatagttttaatccagagttgcaatcgataaaaactataaacggatagtcatacgatgtctgaaaattttctagattttattgaaggtattcagctaa |
4365736 |
T |
|
| Q |
117 |
cctatgaagtatgaacatgatgcaattggtcccgtctaaaaatattgttccaagaatttatgaaaaatcacacactgaacatgttttatgcagtagtttt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
4365737 |
cctatgaagtatgaacatgatgcaattggtcccgtctaaaaatattgttccaagaatttatgaaaaatcacacactgaacatgttttgtgcagtagtttt |
4365836 |
T |
|
| Q |
217 |
catgctttctctagttcatctaaataagtatctttctttctttttaagcatgtacaaagttcatatccggaaccaaacttcaagttcat |
305 |
Q |
| |
|
|| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4365837 |
caggctttctctagttcatctaaacaagtatctttctttctttttaagcatgtacaaagttcatatccggaaccaaacttcaagttcat |
4365925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University