View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11089_low_48 (Length: 260)
Name: NF11089_low_48
Description: NF11089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11089_low_48 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 82; Significance: 8e-39; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 129 - 245
Target Start/End: Complemental strand, 42981783 - 42981667
Alignment:
| Q |
129 |
caacatagttgaagattgtaaaaattatatcatttaatacccaagcaaatttgcttnnnnnnnnntacccaagcaaattgaagacacgccaatgtctact |
228 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
42981783 |
caacatagttgaagattgcaaaaattatatcatttaatacccaagcaaatttgcttaaaaaaaaatacccaagcaaattgaagacacaccaatgtctact |
42981684 |
T |
|
| Q |
229 |
gattatatttatctgtg |
245 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
42981683 |
gattatatttatctgtg |
42981667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 18 - 65
Target Start/End: Complemental strand, 42981894 - 42981847
Alignment:
| Q |
18 |
gaaagttggtatttggtggcatagtcctaaatttttcatttatggggg |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42981894 |
gaaagttggtatttggtggcatagtcctaaatttttcatttatggggg |
42981847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University