View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11089_low_52 (Length: 252)
Name: NF11089_low_52
Description: NF11089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11089_low_52 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 38953747 - 38953980
Alignment:
| Q |
1 |
catccgagaatgaggaagtgttgcttgtgtttatatggagtatttggaagagcagaagtgcgacaacgtgggaaatcaaacggatagaccagctgatttt |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
38953747 |
catcagagaatgaggaagtgttgcttgtgtttatatggagtatttggaagagcagaagtgcgacaacgtgggaaatcaaacggatagaccagctgaattt |
38953846 |
T |
|
| Q |
101 |
gttcattgcagcagaaggtttgttggaggagttgctaaaagcttgtgatacatgtttgcattggactagttctagtaagattgtgattcgaaaaacccac |
200 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38953847 |
gttcattgcagcagaatgtttgttggaggagttgctacaagcttgtgatacatgtttgcattggactagttctagtaagattgtgattcgaaaaacccac |
38953946 |
T |
|
| Q |
201 |
ctcattcaagagttgttgatcgcactgagcttgg |
234 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |
|
|
| T |
38953947 |
ctcattctagagttgttgatcgcactgagcttgg |
38953980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University