View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11090_high_20 (Length: 387)
Name: NF11090_high_20
Description: NF11090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11090_high_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 90 - 368
Target Start/End: Complemental strand, 19468575 - 19468298
Alignment:
| Q |
90 |
actaaaaggttttcttcaaactcctcgaggtttgtagaacttaccatctttatgaggattaggggcagtgggaaatgttaaatgaacttcaccatatgaa |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
19468575 |
actaaaaggttttcttcaaactcctcgaggtttgtagaacttaccatctttatgaggattaggggcagtgggaaatgttaaacgaacttcaccatatgaa |
19468476 |
T |
 |
| Q |
190 |
agtccccttacagttctatatacgtcaagtcccgtcataaacttttgcattttggggcaatata-gggcacccatcccactaggatttaccgaattctcc |
288 |
Q |
| |
|
||||||||||||||||||||| |||||| ||| |||||| ||||||||||||||||||||||| ||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
19468475 |
agtccccttacagttctatat--gtcaagccccatcataaccttttgcattttggggcaatataggggcacccatcccaccaggatttcccgaattctcc |
19468378 |
T |
 |
| Q |
289 |
atcagtgtggtatataacaaatagcaataaaatgaggatagtacgagaaaaataccttccaagttaggattggaagatta |
368 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
19468377 |
atcagtgtggtatataaaaaatagcaataaaatgaggatagtacgagaaaaataccttcgaagttaggattggaagatta |
19468298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University