View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11090_high_5 (Length: 542)
Name: NF11090_high_5
Description: NF11090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11090_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 450; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 450; E-Value: 0
Query Start/End: Original strand, 17 - 529
Target Start/End: Complemental strand, 35827025 - 35826507
Alignment:
| Q |
17 |
aatacacaacactgaggtatcgatatgaatttgtagctcaatgtgtgtcggggttttcagtcaccaaacccaacccaacatgttgtcctctacaagattg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35827025 |
aatacacaacactgaggtatcgatatgaatttgtagctcaatgtgtgtcggggttttcagtcaccaaacccaacccaacatgttgtcctctacaagattg |
35826926 |
T |
 |
| Q |
117 |
tcccttatatcaacggcaatgatctattaatagaatcctgaccgtttattctctgtcgtgtacggtcaaaatcataggggtcaacaacatcagatcataa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35826925 |
tcccttatatcaacggcaatgatctattaatacaatcgtgaccgtttattctctgtcgtgtacggtcaaaatcataggggtcaacaacatcagatcataa |
35826826 |
T |
 |
| Q |
217 |
cacacacatcattttctacagaccattgttgatgtgaaggattcacgcttgcatgttgaattgcatgccacaacctttgcacgtgcaaagttttttattt |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35826825 |
cacacacatcattttctacagaccattgttgatgtgaaggattcacgcttgcatgttgaattgcatgccacaacctttgcacgtgcaaagttttttattt |
35826726 |
T |
 |
| Q |
317 |
gagtgtggggtccactaaagccagagtggctcgtgtcaagttagtcaggtcacggtcaagccgtgtgggttgggtcttgatgttggctaggggactgagc |
416 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
35826725 |
gagtgtggggtccactaaagccagagtggctcgtgtcaagttagtcaggtcacggtcaagccgtgtgagttgggtcttgatgttggctaggggactgagc |
35826626 |
T |
 |
| Q |
417 |
ccatgggtcacgtgaacgatcgacac------nnnnnnnnnngaagaacgatcgacacttttgtttaccaactttatcttctttttatggttacaaaagc |
510 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35826625 |
ccatgggtcacgtgaacgatcgacacttttttttttttttttgaagaacgatcgacccttttgtttaccaactttatcttctttttatggttacaaaagc |
35826526 |
T |
 |
| Q |
511 |
ttttcattgctctttgtct |
529 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
35826525 |
ttttcattgctctttgtct |
35826507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University