View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11090_high_51 (Length: 254)
Name: NF11090_high_51
Description: NF11090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11090_high_51 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 75 - 241
Target Start/End: Original strand, 52390568 - 52390734
Alignment:
| Q |
75 |
aatcaatcttctggtaataaattcttgtattacggacacgtgtttagacttagttaggagtagttgatttggagcagggcaatttgtgtgtaacttgtcc |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
52390568 |
aatcaatcttctggtaataaattcttgtattacggacacgtgtttagacttagttaggagtagttgatttggagcagggcagtttgtgtgcaacttgtcc |
52390667 |
T |
 |
| Q |
175 |
ctctccttgtgtcaacgctttaatttttgtaataaattcttctccaagttgcattttctattcgtct |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52390668 |
ctctccttgtgtcaacgctttaatttttgtaataaattcttctccaagttgcattttctattcgtct |
52390734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University