View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11090_high_55 (Length: 246)
Name: NF11090_high_55
Description: NF11090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11090_high_55 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 125 - 185
Target Start/End: Complemental strand, 3597143 - 3597083
Alignment:
| Q |
125 |
agaggacattgctgcaaatgtgtcatgttattattcaatgacttgaaaaccctaatcaaag |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3597143 |
agaggacattgctgcaaatgtgtcatgttattattcaatgacttgaaaaccctaatcaaag |
3597083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University