View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11090_low_14 (Length: 442)
Name: NF11090_low_14
Description: NF11090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11090_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 16 - 203
Target Start/End: Complemental strand, 2744425 - 2744238
Alignment:
| Q |
16 |
aggttgatatcctccatttcctaaggctactagataaatggatacatagaataaagtagtttcatatgatgaatgtgttccacaaggtaattctttagac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2744425 |
aggttgatatcctccatttcctaaggctactagataaatggatacatagaataaagtagtttcatatgatgaatgtgttccacaaggtaattctttagac |
2744326 |
T |
 |
| Q |
116 |
ccacaaccattaggtttcaataggaagatgtaagatgtcaatgataatgccaccaaaccctgtcatatagaaatttattaattctcat |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2744325 |
ccacaaccattaggtttcaataggaagatgtaagatgtcaatgataatgccaccaaaccctgtcatatagaaatttattaattctcat |
2744238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 226 - 268
Target Start/End: Complemental strand, 2744241 - 2744199
Alignment:
| Q |
226 |
tcataatatatgtttatctcaatattttgtagaattgaataac |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2744241 |
tcataatatatgtttatctcaatattttgtagaattgaataac |
2744199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University