View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11090_low_26 (Length: 356)
Name: NF11090_low_26
Description: NF11090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11090_low_26 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 16 - 328
Target Start/End: Complemental strand, 30737584 - 30737279
Alignment:
| Q |
16 |
cataatttaacatg-atgtatataaaacatctatgatgcttcttttgtattggaggcttccaatagattttgtgtccttgcttcaatgatgaattcattg |
114 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
30737584 |
cataagttaacatggatgtatataaaacatctatgatacttcttttgtattggaggcttccaatagatttcgtgtccttgcttcaaggatgaattcattc |
30737485 |
T |
 |
| Q |
115 |
catagtgtttacatcgagagatgtaagttggctcggatgtatttaaaacattcgagaccaggcatttttctacaaatgctcgacttggtttttactgaat |
214 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
30737484 |
catagtgtttacat--------gtaagttggctcggatgtatttaaaacattcgagaccaggcatttttctacaaatgctcgacttggtttttcctgaat |
30737393 |
T |
 |
| Q |
215 |
taaaccaatgatggggtagaggaaccttgatcttcccttcattattgaattagaggaacaattgttccatcagaggatcgattacatgactcagatttct |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30737392 |
taaaccaatgatggggtagaggaaccttgatcttcccttcattattgaattagaggaacaattgttccatcagaggatcgattacatgactcagatttct |
30737293 |
T |
 |
| Q |
315 |
tagcctttgcttct |
328 |
Q |
| |
|
||||| ||| |||| |
|
|
| T |
30737292 |
tagccattgtttct |
30737279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University