View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11090_low_51 (Length: 255)
Name: NF11090_low_51
Description: NF11090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11090_low_51 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 15 - 255
Target Start/End: Original strand, 37719337 - 37719577
Alignment:
| Q |
15 |
aacaaacaccaaacagaaatttaacatccaaaacgaccaatttagaacccctgctgtaaaagaagcccacacttacatgtgttactcgatctcggtcatt |
114 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
37719337 |
aacaaacacaaaacagaaatttaacatccaaaacgaccaatttagaacccctgctgtaaaagaagcccacacttgcatgtgttactcgatctcagtcatt |
37719436 |
T |
 |
| Q |
115 |
aatttgagatcgattggtttaaattacgcttttaccaaattattgctaaacaattgattcaagataaaatggcactaaggaaaaacattatatcattact |
214 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37719437 |
aatttgagattgattggtttaaattacgcttttaccaaattattggtaaacagttgattcaagataaaatggcactaaggaaaaacattatatcattact |
37719536 |
T |
 |
| Q |
215 |
ggtcaatataaatttcagagaacaatttagtaacataattt |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37719537 |
ggtcaatataaatttcagagaacaatttagtaacataattt |
37719577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University