View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11090_low_69 (Length: 215)
Name: NF11090_low_69
Description: NF11090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11090_low_69 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 50509767 - 50509968
Alignment:
| Q |
1 |
taaagcagaaggaatgtagccataccactttgttagagctttgagaaaatggtcatgagcattccgaagggcagtcacataccaattctgaagcnnnnnn |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50509767 |
taaagcagaaggaatgtagccataccactttgttagagctttgagaaaatggtcatgagcattccgaagggcagtcacataccaattctgaagctttttt |
50509866 |
T |
 |
| Q |
101 |
nnnnagtaagtcaattctgaagcattgttgatcatcaaaaggatttgcatccaccgggtctggtgctgcactggaccgtgttgttcaccatgattggtct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
50509867 |
ttttagtaagtcaattctgaagcattgttgatcatcaaaaggatttgcatccaccgggtctggtgctgcactggaccatgttgttcaccctgattggtct |
50509966 |
T |
 |
| Q |
201 |
tc |
202 |
Q |
| |
|
|| |
|
|
| T |
50509967 |
tc |
50509968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University