View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11090_low_70 (Length: 208)
Name: NF11090_low_70
Description: NF11090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11090_low_70 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 120; Significance: 1e-61; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 62 - 181
Target Start/End: Complemental strand, 31624042 - 31623923
Alignment:
| Q |
62 |
gttgttggaaagaaaccaacgggtaggaaaggaagaagaggattggggactggtccaaaaacggagaatgctcagggaataacaattccaccaaaaactt |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31624042 |
gttgttggaaagaaaccaacgggtaggaaaggaagaagaggattggggactggtccaaaaacggagaatgctcagggaataacaattccaccaaaaactt |
31623943 |
T |
|
| Q |
162 |
ctgatgatgatcaacatgac |
181 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
31623942 |
ctgatgatgatcaacatgac |
31623923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 31605422 - 31605386
Alignment:
| Q |
1 |
ataactatatttgttgtttctctttagaaaatgtgct |
37 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
31605422 |
ataactatatttgttgtttctcttcagaaaatgtgct |
31605386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 31624103 - 31624067
Alignment:
| Q |
1 |
ataactatatttgttgtttctctttagaaaatgtgct |
37 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
31624103 |
ataactatatttgttgtttctcttcagaaaatgtgct |
31624067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 75 - 172
Target Start/End: Complemental strand, 31608473 - 31608376
Alignment:
| Q |
75 |
aaccaacgggtaggaaaggaagaagaggattggggactggtccaaaaacggagaatgctcagggaataacaattccaccaaaaacttctgatgatgat |
172 |
Q |
| |
|
||||||||||||| | |||||| ||| |||||||||| ||| ||| ||||||| ||||| | ||||| ||||||||||| ||||||||||||| |
|
|
| T |
31608473 |
aaccaacgggtagcacaggaagcgaaggtttggggactgatccgcaaatggagaatcctcagctaccaacaaatccaccaaaaaattctgatgatgat |
31608376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University