View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11091_high_8 (Length: 432)
Name: NF11091_high_8
Description: NF11091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11091_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 2e-87; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 2e-87
Query Start/End: Original strand, 194 - 377
Target Start/End: Complemental strand, 42994793 - 42994610
Alignment:
| Q |
194 |
aagtatgtcatctaactataaatataggtgcggtgctatcgaaaggcttgccattctcattctaaactcacttagcatcacgtgtttgtatcaaaaaatg |
293 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
42994793 |
aagtatgtcatgtaactataaatataggtgcggtgctatcgaaaggcttgccattctcattctaaactcacttagcatcacatgtttgtatcaaaaaatg |
42994694 |
T |
 |
| Q |
294 |
gctttacgtgagtttgagagcttacttgctttggtttgcttgaaaggtcccatactctttgtttattatgttcatggtttattt |
377 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
42994693 |
gctttacgtgagtttgagagcttacttgctttgatttgcttgaaaggtcccataatctttgtttattatgtttatggtttattt |
42994610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 22 - 107
Target Start/End: Complemental strand, 42995390 - 42995305
Alignment:
| Q |
22 |
tcgtttcatcctagggttttattattactgttattggcaattagatatctgaaatttggtgtcatgcttcagagttagatgatgga |
107 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
42995390 |
tcgtttcatcctagggttttattgttactgttattggcaattagatatctgaaatttggtggcatgcttcagagttagaggatgga |
42995305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University