View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11092_high_17 (Length: 372)
Name: NF11092_high_17
Description: NF11092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11092_high_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 133; Significance: 4e-69; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 219 - 355
Target Start/End: Original strand, 1270673 - 1270809
Alignment:
| Q |
219 |
gataggtacactgcaaggacgttgtagtagaacatggagatgtatccaaagctttaattgaatatacttctcaatcagcaattgagcatttggttctagg |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1270673 |
gataggtacactgcaaggacgttgtagtagaacatggagatgtatgcaaagctttaattgaatatacttctcaatcagcaattgagcatttggttctagg |
1270772 |
T |
 |
| Q |
319 |
ctgttccaacaaaaatggttttctcaagtattcttct |
355 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1270773 |
ctgttccaacaaaaatggttttctcaagtattcttct |
1270809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 1 - 135
Target Start/End: Original strand, 1270455 - 1270589
Alignment:
| Q |
1 |
tagcatgcttgagcagggttcagtggtgggcaaagaacctgatgaacaaaccaaagaaattttccgtccatatcgtgtcttttgtgcgcgaaaagatgta |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1270455 |
tagcattcttgagcagggttcagtggtgggcaaagaacctgatgaacaaaccaaagaaattttccgtccatatcgtgtcttttgtgcgcgaaaagatgta |
1270554 |
T |
 |
| Q |
101 |
agtttcacnnnnnnnccaggatagaaaacaagagg |
135 |
Q |
| |
|
|||||||| |||||||||||||||||||| |
|
|
| T |
1270555 |
agtttcacttttttcccaggatagaaaacaagagg |
1270589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 9 - 74
Target Start/End: Original strand, 1257459 - 1257524
Alignment:
| Q |
9 |
ttgagcagggttcagtggtgggcaaagaacctgatgaacaaaccaaagaaattttccgtccatatc |
74 |
Q |
| |
|
||||| |||||||| ||||| ||||| | ||| ||||||||||||||||||| || |||| ||||| |
|
|
| T |
1257459 |
ttgaggagggttcactggtgtgcaaaaagcctaatgaacaaaccaaagaaatgtttcgtctatatc |
1257524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University