View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11092_high_31 (Length: 304)
Name: NF11092_high_31
Description: NF11092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11092_high_31 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 280
Target Start/End: Complemental strand, 34289256 - 34288977
Alignment:
| Q |
1 |
cctacctccaaaagttgagggcggttaggttggttgaggagattgtgatgcaaatcggagggaagaatctgcnnnnnnnnngaa------gagaaatgta |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
34289256 |
cctacctccaaaagttgagggcggttaggttggttgaggagattgtgatgcaaatcggagggaagaatctgcaaaaaaaaaaaaaaaagagagaaatgta |
34289157 |
T |
|
| Q |
95 |
agaaaggaaatgattgaacatgaagaaggttggggaatggaacgagaagtacctgtaagagagcttgaaggtcgtcgttgtgcaaaagagaacactgtga |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
34289156 |
agaaaggaaatgattgaacatgaagaaggttggggaatggaacgagaagtacctgtaagagagcttgaaggtcgtcgttgtgcacaagagaacactgtga |
34289057 |
T |
|
| Q |
195 |
ctgtgactgtggctgagtcgcatagcatttgaatttgagggtcggtggtgacttcaatttccatgttgatgttgctgcaatcaaac |
280 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
34289056 |
ctgtga------ctgagtcgcatagcatttgaatttgagggtcggtggtgacttcaatttccatgttgatgtcgctgcaatcaaac |
34288977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 8 - 56
Target Start/End: Original strand, 425328 - 425376
Alignment:
| Q |
8 |
ccaaaagttgagggcggttaggttggttgaggagattgtgatgcaaatc |
56 |
Q |
| |
|
||||||| | ||||| |||| ||||||||||| |||||||||||||||| |
|
|
| T |
425328 |
ccaaaagcttagggctgttatgttggttgaggcgattgtgatgcaaatc |
425376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University