View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11092_high_38 (Length: 265)
Name: NF11092_high_38
Description: NF11092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11092_high_38 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 12 - 249
Target Start/End: Complemental strand, 40513431 - 40513209
Alignment:
| Q |
12 |
agcaaaggcaggatcatagtggttgcttcgggctgtggatggttcccacttccaagattaagtatctataatgtaaacatagacattagttcatttcaat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40513431 |
agcaaaggcaggatcatagtggttgcttcgggctgtggatggttcccacttccaagattaagtatctataatgtaaacatagacattagttcatttcaat |
40513332 |
T |
 |
| Q |
112 |
tttattttaatttacttttcaatttgtttatgagccaaaataatagtcttaaactgtgattatatacgttatggtatcaggctagtaaggctgcgacaat |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40513331 |
tttattttaatttacttttcaatttgtttatgagccaaaataatagtct---------------tacattatggtatcaggctagtaaggctgcgacaat |
40513247 |
T |
 |
| Q |
212 |
aagcttctttgagactctaagaattgaacttggttggt |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40513246 |
aagcttctttgagactctaagaattgaacttggttggt |
40513209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 249
Target Start/End: Complemental strand, 40527170 - 40527104
Alignment:
| Q |
186 |
tatcaggctagtaaggctgcgacaataa---gcttctttgagactctaagaattgaacttggttggt |
249 |
Q |
| |
|
||||||||||||||||| |||| ||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40527170 |
tatcaggctagtaaggcagcgataataataagcttctttgagactttaagaattgaacttggttggt |
40527104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University