View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11092_high_50 (Length: 236)
Name: NF11092_high_50
Description: NF11092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11092_high_50 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 6 - 222
Target Start/End: Original strand, 12529206 - 12529415
Alignment:
| Q |
6 |
ctggatgaacttcagcaacagaagcaccgaacaatgacaacagcaggatccgaggaagatagagcaatcttgggtcagaatagtggacatgcaccac-aa |
104 |
Q |
| |
|
||||| ||||||||| ||||| || ||| |||||| |||||||| |||||| |||||||||||| |||| ||||||||||||||||||||||||||| || |
|
|
| T |
12529206 |
ctggacgaacttcagtaacagcagaaccaaacaataacaacagccggatccaaggaagatagagtaatcctgggtcagaatagtggacatgcaccacaaa |
12529305 |
T |
|
| Q |
105 |
cataggtggacagttccggtgagaggcgaagttaagtgtaacgtggatgcaccaatcttcaacgacaaaaattgtttttagtgctgctatgtgtgttaga |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
12529306 |
cataggtggacagttccggtgagaggcgaagttaagtgtaacgaggatg-------cttcaacgacaaaaattg-ttttagtgctgctatgtgtgataga |
12529397 |
T |
|
| Q |
205 |
aacgaaagaggtgaattc |
222 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
12529398 |
aacgaaagaggtgaattc |
12529415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University