View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11092_high_50 (Length: 236)

Name: NF11092_high_50
Description: NF11092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11092_high_50
NF11092_high_50
[»] chr8 (1 HSPs)
chr8 (6-222)||(12529206-12529415)


Alignment Details
Target: chr8 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 6 - 222
Target Start/End: Original strand, 12529206 - 12529415
Alignment:
6 ctggatgaacttcagcaacagaagcaccgaacaatgacaacagcaggatccgaggaagatagagcaatcttgggtcagaatagtggacatgcaccac-aa 104  Q
    ||||| ||||||||| ||||| || ||| |||||| |||||||| |||||| |||||||||||| |||| ||||||||||||||||||||||||||| ||    
12529206 ctggacgaacttcagtaacagcagaaccaaacaataacaacagccggatccaaggaagatagagtaatcctgggtcagaatagtggacatgcaccacaaa 12529305  T
105 cataggtggacagttccggtgagaggcgaagttaagtgtaacgtggatgcaccaatcttcaacgacaaaaattgtttttagtgctgctatgtgtgttaga 204  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||       |||||||||||||||||| |||||||||||||||||||| ||||    
12529306 cataggtggacagttccggtgagaggcgaagttaagtgtaacgaggatg-------cttcaacgacaaaaattg-ttttagtgctgctatgtgtgataga 12529397  T
205 aacgaaagaggtgaattc 222  Q
    ||||||||||||||||||    
12529398 aacgaaagaggtgaattc 12529415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University