View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11092_high_53 (Length: 217)
Name: NF11092_high_53
Description: NF11092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11092_high_53 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 5462231 - 5462015
Alignment:
| Q |
1 |
aagtaacaattgggttgggatgatttgataaagcatgtaaaagttgtaagtgatttaattgatgggttaggacgagggcggttactttacttttcaggaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5462231 |
aagtaacaattgggttgggatgatttgataaagcatgtaaaagttgtaagtgatttaattgatgggttaggacgagggaggttactttacttttcaggaa |
5462132 |
T |
 |
| Q |
101 |
ctgggaaactttccattaactgtttggttgtaatgtgatttagttatggtaagtggcataagattggatttgatgcattgaactggtacggtacaatgct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5462131 |
ctgggaaactttccattaactgtttggttgtaatgtgatttagttatggtaagtggcataagattggatttgatgcattgaactggtacggtacaatgct |
5462032 |
T |
 |
| Q |
201 |
tcttgcttgtactttct |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
5462031 |
tcttgcttgtactttct |
5462015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University