View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11092_high_55 (Length: 213)
Name: NF11092_high_55
Description: NF11092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11092_high_55 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 52 - 197
Target Start/End: Original strand, 37495599 - 37495747
Alignment:
| Q |
52 |
tttagagaaagt-atgatgttttattatataaactatattttagtccaactcattaatctcttaa-gtannnnnnnn-ctagatattcatatgtgaatct |
148 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||| ||||||||||||||| ||||| ||| |||||||||||||||||||||| |
|
|
| T |
37495599 |
tttagagaaagtcatgatgttttattatataaattatattttaatccaactcattaatcacttaaagtatttttttttctagatattcatatgtgaatct |
37495698 |
T |
|
| Q |
149 |
aactacacttaatttgatctaactctcactaaaaaatgtataggtctct |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
37495699 |
aactacacttaatttgatctaactctcactataaaatttataggtctct |
37495747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 78 - 110
Target Start/End: Original strand, 16971826 - 16971858
Alignment:
| Q |
78 |
tataaactatattttagtccaactcattaatct |
110 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
16971826 |
tataaactatatttcagtccaactcattaatct |
16971858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University