View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11092_low_18 (Length: 376)
Name: NF11092_low_18
Description: NF11092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11092_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 8e-77; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 8e-77
Query Start/End: Original strand, 212 - 361
Target Start/End: Complemental strand, 340923 - 340774
Alignment:
| Q |
212 |
aaatacctgtgaggccaattctttgtatcatcttcagagtttttgagaaccaaatcaacgaaagctctactgttgctatttgttggaaagggaggaggat |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
340923 |
aaatacctgtgaggccaattctttgtatcatcttcagagtttttgagaaccaaatcaacgaaagctctactgttgctatttgttggaaagggaggaggat |
340824 |
T |
 |
| Q |
312 |
taggatctaaggtccacaacttgttccttgcaaatccatgatgttcaaga |
361 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
340823 |
taggatctaagatccacaacttgttccttgcaaatccatgatgttcaaga |
340774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 9 - 166
Target Start/End: Complemental strand, 341122 - 340965
Alignment:
| Q |
9 |
gttgggtgaaggtgaacattgatggctcaacagaaggtgaacctcggcatgctttgtgtgggggaattttcaaagatcaccgagcttctttccaggttga |
108 |
Q |
| |
|
|||||||||| |||||||| ||||||| | ||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||| ||||||| |
|
|
| T |
341122 |
gttgggtgaatgtgaacatcaatggctcgatagaaggtgaacctcggcatgctttgtgtgggggaattttcagagatcactgagcttctttctaggttga |
341023 |
T |
 |
| Q |
109 |
acatttggattgaaattgacttttaagatgtctaccaatcattttgatgttggttctt |
166 |
Q |
| |
|
| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
341022 |
aaatttggattgaaattgactttcaagatgtctaccaatcattttgatgttggttctt |
340965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University