View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11092_low_26 (Length: 334)
Name: NF11092_low_26
Description: NF11092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11092_low_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 3e-88; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 154 - 326
Target Start/End: Complemental strand, 35837942 - 35837770
Alignment:
| Q |
154 |
aggtcacagggtcacacccctttgtttggatttgaactcagataaaaatatttaacagaaatttcaaaatgcagcagcacctgatgcagatgcagcccat |
253 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35837942 |
aggtcacagggtcatacccctttgtttggatttgaactcagataaaaatatttaacagaaatttcaaaatgcagcagcacctgatgcagatgcagcccat |
35837843 |
T |
 |
| Q |
254 |
gatggcagcttactatcctaacaacgtcactactgatcatattcaacaggttcctttcttctttcttcatctc |
326 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35837842 |
gatggcagcttactatcctaacaacgtcactactgatcatattcaacaggttcctttcttctttcttcttctc |
35837770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 21 - 98
Target Start/End: Complemental strand, 35838085 - 35838008
Alignment:
| Q |
21 |
cactcttctaagtgttgtgtagtaacataacatagcatcatcattcatcaatagtaacacagagaaaatcagaccaga |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
35838085 |
cactcttctaagtgttgtgtagtaacataacatagcatcatcattcatcaacagtaacacagagaaaatcagaccaga |
35838008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 69; Significance: 6e-31; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 220 - 300
Target Start/End: Original strand, 47685091 - 47685171
Alignment:
| Q |
220 |
aaatgcagcagcacctgatgcagatgcagcccatgatggcagcttactatcctaacaacgtcactactgatcatattcaac |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||| ||||||| |
|
|
| T |
47685091 |
aaatgcagcagcacctgatgcagatgcagcccatgatggcagcttactatccaaacaacgtcaccactgatcacattcaac |
47685171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University