View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11092_low_45 (Length: 253)
Name: NF11092_low_45
Description: NF11092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11092_low_45 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 19 - 195
Target Start/End: Original strand, 24300782 - 24300958
Alignment:
| Q |
19 |
gttgtcgttgttggtagaaatatttc-atatattacatgagtacaagacctaagagaagacagaagccccctcatagtttattccatgagttatgattta |
117 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||||||||||||||||||||| | |||| | ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
24300782 |
gttgtcgttgttggtagaaatatatccatatattacatgagtacaagacctaagaaaggacaca-gcctcctcatagtttattccatgagttatgattta |
24300880 |
T |
|
| Q |
118 |
gttattgtgttgtcataaaataatttgatattcttatagtttttctaatttcacagatgtagttattgctttgtactc |
195 |
Q |
| |
|
||||||||| |||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
24300881 |
gttattgtgctgtcataaaataatttgacattcttatagtttttctaatttcatagatgtagttattgctttgtactc |
24300958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University