View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11092_low_47 (Length: 250)
Name: NF11092_low_47
Description: NF11092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11092_low_47 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 34 - 239
Target Start/End: Complemental strand, 6632887 - 6632682
Alignment:
| Q |
34 |
tacatatccatttagttgatcttttcaaaaaggttaaattacatatttaatttcttacgtttattttagatttaaagtatgtcatttatggttaaaaagt |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6632887 |
tacatatccatttagttgatcttttcaaaaaggttaaattacatatttaatctcttacgtgtattttagatttaaagtatgtcatttatggttaaaaagt |
6632788 |
T |
 |
| Q |
134 |
aagtttccatggttaagtgatgtttattttagatttaaaattggtcatttacgtttaaaaagtttccatggttaagtgatttacttactcactctgttat |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||| ||||||||||||||||||||||||||||| | || |
|
|
| T |
6632787 |
aagtttccatggttaagtgatgtttattttagatttaaaattggtcgtttacatttaaaaagttttcatggttaagtgatttacttactcactctatcat |
6632688 |
T |
 |
| Q |
234 |
attcat |
239 |
Q |
| |
|
|||||| |
|
|
| T |
6632687 |
attcat |
6632682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University