View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11092_low_52 (Length: 240)
Name: NF11092_low_52
Description: NF11092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11092_low_52 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 119 - 224
Target Start/End: Original strand, 46613543 - 46613648
Alignment:
| Q |
119 |
attatgtgaaagtttgtatttagagttaaataattaaagtggcaaaatacatctcttgaagatcatattggatttgaaattatgtttcagtgttggaagt |
218 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
46613543 |
attatgtgaaagtttgtacttagagttaagtaattaaagtggcaaaatacatctcttgaagatcatattggatttgaaactatgtttcagtgttggaagt |
46613642 |
T |
|
| Q |
219 |
tattct |
224 |
Q |
| |
|
|||||| |
|
|
| T |
46613643 |
tattct |
46613648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 119 - 224
Target Start/End: Original strand, 50157212 - 50157317
Alignment:
| Q |
119 |
attatgtgaaagtttgtatttagagttaaataattaaagtggcaaaatacatctcttgaagatcatattggatttgaaattatgtttcagtgttggaagt |
218 |
Q |
| |
|
||||||| |||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||| ||||||||| | ||||||||||||||||| |
|
|
| T |
50157212 |
attatgtaaaagtttgtatttagaattaagtaattaaagtggcaaaatacatctcttgaagatcatattagatttgaaactctgtttcagtgttggaagc |
50157311 |
T |
|
| Q |
219 |
tattct |
224 |
Q |
| |
|
|||||| |
|
|
| T |
50157312 |
tattct |
50157317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 82; Significance: 8e-39; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 119 - 224
Target Start/End: Original strand, 9456355 - 9456460
Alignment:
| Q |
119 |
attatgtgaaagtttgtatttagagttaaataattaaagtggcaaaatacatctcttgaagatcatattggatttgaaattatgtttcagtgttggaagt |
218 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||| | ||||||||||||||||| |
|
|
| T |
9456355 |
attatgtaaaagtttgtatttagagttaagtaattaaagtggcaaaatacatctcttgaagatcatattagatttgaaactctgtttcagtgttggaagc |
9456454 |
T |
|
| Q |
219 |
tattct |
224 |
Q |
| |
|
|||||| |
|
|
| T |
9456455 |
tattct |
9456460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University