View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11092_low_53 (Length: 238)
Name: NF11092_low_53
Description: NF11092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11092_low_53 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 96 - 220
Target Start/End: Original strand, 5554965 - 5555089
Alignment:
| Q |
96 |
cttaaagaaaaagtctggcccaatttaagcctcatgcagaataatcagtaggttcttgtcagccaatctatcttatttccccctagttggaatgtatgta |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5554965 |
cttaaagaaaaagtctggcccaatttaagcctcatgcagaataatcagtaggttcttgtcagccaatctatcttatttccccctagttggaatgtatgta |
5555064 |
T |
 |
| Q |
196 |
tatactcaattagaagtttgagaag |
220 |
Q |
| |
|
||||||||||| ||||||||||||| |
|
|
| T |
5555065 |
tatactcaattggaagtttgagaag |
5555089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University